Flavinkins (@Flavinkins)
Posted
2 replies · 2 reposts · 2 likes
https://www.trialsitenews.com/a/darpa-memo-united-states-created-sars-cov-2-ce1b0433 Apparently funding through one’s overlord doesn’t count as “funding directly or as a subcontractor”? https://archive.md/71Di3 https://archive.md/SNZkm https://archive.ph/Nfu5p https://archive.is/6qUW3 https://archive.ph/CFNcS The CTCCTCGGCGGGGCACGTAG sequence and the SPRRARS sequence it encoded is designed for maximal immunogenicity. https://archive.ph/qXMsd it is the reason why you can have a working vaccine against the Wuhan strain.